It’ll soon be easier than ever to get your hands on DNA digital data storage – although it won’t come cheaply. French startup Biomemory is selling a credit card-sized device that can store short messages encoded by DNA.DNA is essentially a natural repository of data‚ encoding genetic information using four nucleotide bases (A‚ G‚ C‚ and T). This is not dissimilar to the way digital information is stored by binary code through 0s and 1s.DNA is unbelievably efficient at storing information‚ capable of storing 215 petabytes (215 million gigabytes) in a single gram. It’s estimated that DNA‚ in theory‚ could store the totality of all the world's data in one room. Alternatively‚ you could store around 36 million copies of a 720p HD feature-length film within just one gram of DNA. Building on this idea‚ scientists have recently been toying around with the idea of using DNA to store information just like you would on a hard drive. Biomemory is now bringing this technology to the public for the first time. With a price tag of $1‚000‚ their DNA Cards will allow users to store 1024 bytes of text‚ which is roughly 200 words. "The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology. After years of talk about the potential of molecular computing‚ we are incredibly proud to bring the first DNA data storage product to market‚ that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency‚" Erfane Arwani‚ CEO of Biomemory‚ said in a statement.So‚ for instance‚ the word “hello” could be encoded onto the card by creating a unique strand of DNA using the bases “AGTCTCACAGTCAGAGAGTCTGACAGTCTGACAGTCTGTG”‚ according to a "DNA Translate" feature on Biomemory's website. Once this data is encoded‚ you’ll be sent two cards containing the DNA.To retrieve the data‚ you’ll have to send one of the cards to Eurofins Genomics‚ a German-based biotech company that offers DNA sequencing services. You won’t be able to retrieve the card after the data has been decoded‚ hence why you receive two cards. The lab will then be able to tell you the message encoded onto the card.For now‚ this product is basically a proof-of-concept‚ rather than a viable alternative to memory sticks.Given the enormous potential‚ there’s still a long way to go before DNA digital data storage becomes a practical alternative to conventional means of digital storage. However‚ that is ultimately the mission of Biomemory‚ which aims to use DNA-based storage in data centers. Not only could this dramatically reduce the size of data centers‚ it could potentially make them less energy-intensive‚ which is good news for the planet. 

The plumes pushed out by Enceladus’s geysers are powerful enough that a visiting spacecraft could sample the small moon’s innards without having to land. Moreover‚ they’re also sufficiently gentle that if the molecules needed to get life started exist in Enceladus’s internal ocean‚ they won’t be destroyed by being spat out‚ leaving them free to be collected intact by future space missions. The same should be true for Europa‚ raising the chance that something really exciting awaits us when the Europa Clipper reaches Jupiter.Saturn’s moon Enceladus has a liquid water ocean under its icy shell and several recent studies have revealed all the ingredients for life exist there. What we don’t know is whether these have come together to form amino acids‚ frequently referred to as the “building blocks of life”. However‚ with geysers shooting samples of this ocean into space‚ a spacecraft ought to be able to find out‚ provided we fit it with suitably sensitive equipment.There’s one fly in this ointment‚ or at least there was thought to be. Complex molecules can’t handle extreme forces without breaking up into their component elements‚ or at least simpler molecules. Astrobiologists feared that if Enceladus does have amino acids‚ and perhaps even DNA‚ bobbing around inside‚ they might be destroyed by the impact of slamming into a spacecraft’s collecting plate.If so‚ this would leave future missions none the wiser‚ a sad repetition of the idea we found life on Mars and killed it. If true‚ we would be dependent on landers‚ and probably bizarre robots like this snake‚ to collect samples from the inner ocean intact.The good news is that‚ according to Professor Robert Continetti from the University of California San Diego and colleagues‚ that won’t be necessary‚ because amino acids are tough enough to survive the journey. Indeed‚ the authors calculate‚ they’re rated capable of surviving impact speeds of at least 4.2 kilometers per second (2.6 miles per second)‚ 10 times faster than molecules sprayed out through Enceladus’s geysers are thought to face. This sets a very practical maximum velocity for spacecraft trying to catch grain while passing through a plume.Continetti built an aerosol impact spectrometer to see what happens when aerosols and other particles collide. "This apparatus is the only one of its kind in the world that can select single particles and accelerate or decelerate them to chosen final velocities‚" Continetti said in a statement. "From several micron diameters down to hundreds of nanometers‚ in a variety of materials‚ we're able to examine particle behavior‚ such as how they scatter or how their structures change upon impact." Although not planned that way‚ one thing the spectrometer is excellent at is slamming ice grains‚ like those Enceladus spits out‚ into surfaces and studying the consequences.If‚ as we hope‚ Enceladus has amino acids inside‚ they would probably be carried into space aboard ice grains like this. "The implications this has for detecting life elsewhere in the Solar System without missions to the surface of these ocean-world moons is very exciting‚” Continetti said.We know much less about the situation on Europa‚ where the geysers come and go‚ and any connection to the inner ocean is uncertain. Still‚ while a mission to Enceladus is purely hypothetical‚ all going well we will be sampling particles from Europa’s vicinity quite soon. Consequently‚ it’s very relevant to know amino acids are tough enough that they stand a good chance of survival if any are undergoing a similar journey.The research is open access in Proceedings of the National Academy of Sciences. 

A recent report published by an international team of climate scientists offers a dire warning about the state of the Earth’s vital signs‚ saying they have deteriorated to levels unseen in human history. The report’s lead authors‚ William Ripple and Christopher Wolf‚ and 10 other scientists stress that urgent action is needed to address the root cause of environmental overload‚ which occurs when human demand for the Earth’s resources exceeds its ability to regenerate. The report‚ published in the journal BioScience‚ highlights 20 of 35 planetary vital signs used to track climate change are currently at record extreme levels. The authors cite new data suggesting that numerous climate records will be broken in 2023‚ especially for ocean temperatures and sea ice. They also note unprecedented carbon emissions from Canada’s wildfire season. The report is a follow-up to the Global Scientists’ Climate Emergency Warning‚ published four years ago‚ which was signed by more than 15‚000 scientists from 161 countries. The report’s lead author‚ William Ripple‚ argues that life on our planet is under threat and warns of a possible collapse of natural and socio-economic systems unless urgent action is taken. Key figures presented in the report include a doubling of fossil fuel subsidies between 2021 and 2022‚ reaching more than 1 trillion. In addition‚ the Canadian wildfires in 2023 have already released more carbon dioxide into the atmosphere than all of Canada’s greenhouse gas emissions in 2021. The report also notes an alarming rise in average global temperatures above pre-industrial levels‚ with 38 days in 2023 expected to exceed the 1.5 degrees Celsius threshold. The authors emphasize the need to develop policies that prioritize human well-being and address the overconsumption and excess emissions of the wealthy. Their recommendations include phasing out fossil fuel subsidies‚ promoting plant-based diets‚ protecting forests and implementing international treaties to limit the use of fossil fuels. The authors emphasize that climate action must be based on principles of equity and social justice‚ as the poorest people suffer disproportionately from climate impacts. The report ends with a call to action‚ saying that scientists and institutions have a moral responsibility to disseminate climate facts and make policy recommendations. They argue that scientists must play a leading role in addressing existential threats and alerting humanity to the need for urgent change. The post Earth’s vital signs have reached unprecedented levels appeared first on Anomalien.com.

The Biden White House will not tolerate disruptions during Propaganda Hour‚ otherwise known as the daily press briefing. Monday on the social media platform X‚ journalist Simon Ateba of Today News Africa posted the full text of a letter he reportedly received from the office of White House Press Secretary Karine Jean-Pierre — a letter… The post African Journalist Receives Threatening Letter from White House to Ban Him from Press Events: We ‘Warned You’ appeared first on The Federalist Papers.

As the contenders for the GOP presidential primary prepare to take to the stage in Tuscaloosa‚ AL‚ tonight (Dec. 6)‚ the ever-dwindling audience for these events is likely asking one question: What’s…

The lines have been drawn in Congress over funding for the war in Ukraine and border security. House Speaker Mike Johnson (R-La.) gave what was‚ in effect‚ an ultimatum to the president: no Ukraine funding…

x Republish LibertyNation.com welcomes the republication of our content consistent with the following guidelines: We permit the republishing of up to 250 words of newly published LN articles (the day…

Rep. Jim Jordan (R-Ohio)‚ the chair of the House Judiciary Committee‚ has been investigating Fulton County‚ Ga.‚ District Attorney Fani Willis’s indictment of former President Donald Trump to determine…

Deviations from standard processes provided ‘preferential treatment.’ The three House committees probing potential Biden family corruption on Dec. 5 released a 77-page Interim Staff Report that torches…

Joe Biden was in Massachusetts on Tuesday looking to raise some campaign cash‚ and while speaking with donors he made a rather concerning revelation about his 2024 campaign. Advertisement "But I tell…