Busload of Illegal Aliens Dropped Off at Colorado Capitol

We’re all on that conveyor belt we call life‚ inching ever closer to our expiration date‚ although what happens when we finally reach the end of the line is anyone’s guess. However‚ over the past couple of years‚ researchers have gained some fascinating insights into what happens in the brain as we take our final breath‚ providing a tantalizing sneak peek at the experience of death.For instance‚ in February 2022‚ scientists accidentally recorded the brain activity of an 87-year-old man as he passed away following a heart attack. Prior to this fatal moment‚ the patient had been fitted with a device that continually monitored his brain waves as part of his epilepsy treatment‚ yet the electroencephalography (EEG) recordings from the moment of his death enabled researchers to gain some unexpected insights into what happens when we cross the mortal threshold.Amazingly‚ the EEG showed that brain activity patterns associated with dreaming and memory recall burst into life just as the heart stopped beating‚ continuing for some time after. While it’s impossible to draw any firm conclusions from this information‚ brain activity related to memory retrieval may indicate that we really do see our lives flash before our eyes when we die.This possibility is further strengthened by the results of a subsequent study involving four heart attack patients who died in the neurointensive care unit (NICU) at Michigan Medicine‚ University of Michigan. Monitoring the patients’ neural oscillations as they passed away‚ researchers observed an explosion of activity within the brain’s so-called “hot zone”‚ which sits at the intersection of the temporal‚ parietal‚ and occipital lobes and is linked to both dreaming and conscious thought.However‚ in order to understand how these brain activity patterns translate into actual experience‚ researchers had to talk to people who had died and come back to life. As part of an ongoing project looking into the experiences of patients who have flatlined before being resuscitated‚ scientists recently published insights from a series of interviews conducted at numerous hospitals in the US and UK.Publishing part of their data back in 2019‚ the authors revealed that 86 percent of study participants reported seeing a bright light‚ while 54 percent re-lived and reviewed their major life events‚ confirming two of the most common cliches associated with dying. Overall‚ the experience of death was described as pleasant and uplifting‚ with 95 percent of respondents claiming to have felt a sense of joy and peace as they left their bodies‚ while the same proportion said the event had changed them in a positive way.Presenting more detailed results earlier this year‚ the researchers reveal that many patients were actually aware of the medical procedures being carried out as they underwent CPR‚ despite being apparently comatose. Additionally‚ more than a fifth had what the authors call a “transcendent recalled experience of death‚” meaning their departure and return enabled them to re-evaluate and reframe their life history‚ identity and purpose.Despite these insights‚ death remains a murky subject that continues to evade scientific explanations. For instance‚ it’s unclear how or why the brain responds to its own annihilation by generating such ineffable experiences.One theory – albeit largely speculative and unproven – is that the brain releases the potent psychedelic compound DMT as we die in an attempt to keep neurons alive in the absence of oxygen. If true‚ this may explain some of the spiritual insights gained at the moment of death‚ although more research is needed before such claims can be justified.For now‚ we can’t say for sure what happens when we die. Don’t worry though‚ you’ll find out at some point.[H/T: Popular Mechanics]All “explainer” articles are confirmed by fact checkers to be correct at time of publishing. Text‚ images‚ and links may be edited‚ removed‚ or added to at a later date to keep information current. 

Planetary scientists have released evidence they claim establishes the location where an asteroid hit the Earth three-quarters of a million years ago. Although evidence for the size and timing of the event has been found far and wide‚ it’s been a long road to identify the likely crater in southern Laos.Southeast Asia‚ and even Australia‚ has many rocks produced when an asteroid slammed into the Earth 789‚000 years ago. Known as tektites‚ black glassy rocks of this exact age form the largest debris spray from any extraterrestrial impact‚ even reaching Madagascar and Antarctica. Even larger sprays would have been produced by older and bigger collisions‚ such as the one that caused the Chicxulub Crater‚ but geological processes have long buried the evidence. The tektites known as the Australasian strewn field are recent enough to still be visible in many places‚ while revealing the presence of an impact that must have been the largest at least since Zhamanshin. To spread tektites so widely‚ the impact must have created a large crater‚ but none is obvious. Scientists have been seeking it for decades‚ gradually homing in on the Bolaven Plateau in southern Laos.The combination of geological conditions‚ thick rainforest and one of the world’s most politically isolated nations is probably what has kept the location hidden for so long. A team led by Professor Kerry Sieh of Nanyang Technological University note that “unexploded ordnance hampered field work for decades” after the regions’ wars. Geologists might love their field so much they will explore an exploding volcano‚ but leftover bombs and land mines are a different matter.Nevertheless‚ some secrets cannot be kept forever. As far back as 1983 a gravel deposit had been noted lying just below specimens of the tektites in Vietnam. A dusty layer above‚ which Thai geologists call “catastro-loess”‚ had been proposed as having fallen from the sky after being flung up by the impact. Using these clues Sieh and colleagues zoomed in‚ finally using a layer of pebble- to boulder-sized rocks known as the Bolaven diamicton to identify the site’s location. They believe the diamicton was formed by ancient sandstone and basaltic lava being broken up and tossed in the air by the force of the impact.The idea the crater lies within the Bolaven Volcanic Field has been proposed before – what better place to hide a crater after all – but the evidence has not been strong enough to convince everyone.The location of the Bolaven Volcanic Field in Southeast Asia‚ and the site of the suspected impact crater and tektites of the right age within it.Image credit: Sieh et al‚ Proceedings of the National Academy of Sciences 2023 (CC BY-NC-ND 4.0)The team are seeking to win over skeptical geologists‚ using five separate datasets they say all point to the same site.For example‚ although tektites of the right age are found thousands of kilometers away‚ they are most abundant in the upper part of the diamicton‚ or resting above it. Moreover‚ across most of the region two types of suitably aged tektites‚ MN- and “splashform” are found in similar numbers. However‚ within 200 kilometers (124 miles) of the proposed location MN-type tektites dominate‚ indicating something specific about that location.The study is published open access in Proceedings of the National Academy of Sciences. 

Regular or decaf? French press or Moka pot? Milk‚ cream‚ or neither? If you’re a coffee lover‚ you likely have a preference‚ and discussions about the best brewing method have sparked many a strong opinion and YouTube video essay. But have no fear‚ science is here! A new study brought together a coffee expert and (checks notes) a volcanologist to answer an age-old conundrum about coffee grinding. Coffee is big business‚ worth 1.5 percent of gross domestic product in the US alone. If there is any way of extracting a higher flavor concentration out of the same raw materials‚ coffee producers want to know about it. “Pushing the concentration up by 10%–15% for the same dry coffee mass has huge implications for saving money and improving quality‚” explained senior author Christopher Hendon‚ a computational materials chemist at the University of Oregon‚ in a statement. As you grind coffee beans‚ static electricity is generated in a process called triboelectrification. This is a well-known phenomenon – not least to anyone who has had the unenviable task of cleaning a coffee grinder – but what was less clear was what impact‚ if any‚ it has on the final product. Another place where this same type of static buildup can be found is during a volcanic eruption.“During eruption‚ magma breaks up into lots of little particles that then come out of the volcano in this big plume‚ and during that whole process‚ those particles are rubbing against each other and charging up to the point of producing lightning‚” said volcanologist Joshua Méndez Harper‚ whom we’re willing to bet did not expect to be first author of a paper largely about coffee.“In a simplistic way‚ it’s similar to grinding coffee‚ where you’re taking these beans and reducing them to fine powder.”Hendon‚ Méndez Harper‚ and the team started their investigation by measuring the static electricity generated by various different kinds of coffee beans – different roasts‚ caffeine levels‚ countries of origin‚ and moisture contents.Less static electricity was produced from coffee with higher moisture content and when opting for a coarser grind. Lighter roasts – which tend to be less dry – produced more positive charge‚ but less charge overall than dark roasts. Given that moisture content appeared to be a significant factor‚ could adding water be the answer? The team brewed espresso from identical coffee beans‚ with and without adding a splash of water first – you might have seen baristas spritzing your coffee like this. Adding just a touch of water‚ up to 20 microliters per gram‚ not only improved the consistency of each espresso shot‚ it lengthened the extraction time and produced a stronger brew.   “The central material benefit of adding water during grinding is that you can pack the bed more densely because there’s less clumping‚” Hendon explained. “Espresso is the worst offender of this‚ but you would also see the benefit in brew formats where you pour water over the coffee or in small percolation systems like a stovetop Bialetti. Where you’re not going to see a benefit during brewing is for methods like the French press‚ where you submerge the coffee in water.”So it depends on your approach‚ but if you favor espresso-based beverages in the morning‚ the water trick might be worth a try. And watch this space – the team has more investigations in the offing. “Now that we know what grind settings to use to make reproducible espresso‚ we can start to try to understand what factors give rise to sensory differences in coffee taste‚” said Hendon.Reflecting on this unusual collaboration‚ Méndez Harper said‚ “It’s sort of like the start of a joke – a volcanologist and a coffee expert walk into a bar and then come out with a paper.” But as much as these findings apply to coffee‚ they could also help resolve similar questions that geophysicists have been wrestling with.Started with a latte‚ now we here.The study is published in the journal Matter. 

It’ll soon be easier than ever to get your hands on DNA digital data storage – although it won’t come cheaply. French startup Biomemory is selling a credit card-sized device that can store short messages encoded by DNA.DNA is essentially a natural repository of data‚ encoding genetic information using four nucleotide bases (A‚ G‚ C‚ and T). This is not dissimilar to the way digital information is stored by binary code through 0s and 1s.DNA is unbelievably efficient at storing information‚ capable of storing 215 petabytes (215 million gigabytes) in a single gram. It’s estimated that DNA‚ in theory‚ could store the totality of all the world's data in one room. Alternatively‚ you could store around 36 million copies of a 720p HD feature-length film within just one gram of DNA. Building on this idea‚ scientists have recently been toying around with the idea of using DNA to store information just like you would on a hard drive. Biomemory is now bringing this technology to the public for the first time. With a price tag of $1‚000‚ their DNA Cards will allow users to store 1024 bytes of text‚ which is roughly 200 words. "The launch of our DNA Cards represents a significant milestone in the evolution of data storage technology. After years of talk about the potential of molecular computing‚ we are incredibly proud to bring the first DNA data storage product to market‚ that not only pushes the boundaries of innovation but also aligns with our commitment to environmental sustainability and efficiency‚" Erfane Arwani‚ CEO of Biomemory‚ said in a statement.So‚ for instance‚ the word “hello” could be encoded onto the card by creating a unique strand of DNA using the bases “AGTCTCACAGTCAGAGAGTCTGACAGTCTGACAGTCTGTG”‚ according to a "DNA Translate" feature on Biomemory's website. Once this data is encoded‚ you’ll be sent two cards containing the DNA.To retrieve the data‚ you’ll have to send one of the cards to Eurofins Genomics‚ a German-based biotech company that offers DNA sequencing services. You won’t be able to retrieve the card after the data has been decoded‚ hence why you receive two cards. The lab will then be able to tell you the message encoded onto the card.For now‚ this product is basically a proof-of-concept‚ rather than a viable alternative to memory sticks.Given the enormous potential‚ there’s still a long way to go before DNA digital data storage becomes a practical alternative to conventional means of digital storage. However‚ that is ultimately the mission of Biomemory‚ which aims to use DNA-based storage in data centers. Not only could this dramatically reduce the size of data centers‚ it could potentially make them less energy-intensive‚ which is good news for the planet. 

The plumes pushed out by Enceladus’s geysers are powerful enough that a visiting spacecraft could sample the small moon’s innards without having to land. Moreover‚ they’re also sufficiently gentle that if the molecules needed to get life started exist in Enceladus’s internal ocean‚ they won’t be destroyed by being spat out‚ leaving them free to be collected intact by future space missions. The same should be true for Europa‚ raising the chance that something really exciting awaits us when the Europa Clipper reaches Jupiter.Saturn’s moon Enceladus has a liquid water ocean under its icy shell and several recent studies have revealed all the ingredients for life exist there. What we don’t know is whether these have come together to form amino acids‚ frequently referred to as the “building blocks of life”. However‚ with geysers shooting samples of this ocean into space‚ a spacecraft ought to be able to find out‚ provided we fit it with suitably sensitive equipment.There’s one fly in this ointment‚ or at least there was thought to be. Complex molecules can’t handle extreme forces without breaking up into their component elements‚ or at least simpler molecules. Astrobiologists feared that if Enceladus does have amino acids‚ and perhaps even DNA‚ bobbing around inside‚ they might be destroyed by the impact of slamming into a spacecraft’s collecting plate.If so‚ this would leave future missions none the wiser‚ a sad repetition of the idea we found life on Mars and killed it. If true‚ we would be dependent on landers‚ and probably bizarre robots like this snake‚ to collect samples from the inner ocean intact.The good news is that‚ according to Professor Robert Continetti from the University of California San Diego and colleagues‚ that won’t be necessary‚ because amino acids are tough enough to survive the journey. Indeed‚ the authors calculate‚ they’re rated capable of surviving impact speeds of at least 4.2 kilometers per second (2.6 miles per second)‚ 10 times faster than molecules sprayed out through Enceladus’s geysers are thought to face. This sets a very practical maximum velocity for spacecraft trying to catch grain while passing through a plume.Continetti built an aerosol impact spectrometer to see what happens when aerosols and other particles collide. "This apparatus is the only one of its kind in the world that can select single particles and accelerate or decelerate them to chosen final velocities‚" Continetti said in a statement. "From several micron diameters down to hundreds of nanometers‚ in a variety of materials‚ we're able to examine particle behavior‚ such as how they scatter or how their structures change upon impact." Although not planned that way‚ one thing the spectrometer is excellent at is slamming ice grains‚ like those Enceladus spits out‚ into surfaces and studying the consequences.If‚ as we hope‚ Enceladus has amino acids inside‚ they would probably be carried into space aboard ice grains like this. "The implications this has for detecting life elsewhere in the Solar System without missions to the surface of these ocean-world moons is very exciting‚” Continetti said.We know much less about the situation on Europa‚ where the geysers come and go‚ and any connection to the inner ocean is uncertain. Still‚ while a mission to Enceladus is purely hypothetical‚ all going well we will be sampling particles from Europa’s vicinity quite soon. Consequently‚ it’s very relevant to know amino acids are tough enough that they stand a good chance of survival if any are undergoing a similar journey.The research is open access in Proceedings of the National Academy of Sciences. 

A recent report published by an international team of climate scientists offers a dire warning about the state of the Earth’s vital signs‚ saying they have deteriorated to levels unseen in human history. The report’s lead authors‚ William Ripple and Christopher Wolf‚ and 10 other scientists stress that urgent action is needed to address the root cause of environmental overload‚ which occurs when human demand for the Earth’s resources exceeds its ability to regenerate. The report‚ published in the journal BioScience‚ highlights 20 of 35 planetary vital signs used to track climate change are currently at record extreme levels. The authors cite new data suggesting that numerous climate records will be broken in 2023‚ especially for ocean temperatures and sea ice. They also note unprecedented carbon emissions from Canada’s wildfire season. The report is a follow-up to the Global Scientists’ Climate Emergency Warning‚ published four years ago‚ which was signed by more than 15‚000 scientists from 161 countries. The report’s lead author‚ William Ripple‚ argues that life on our planet is under threat and warns of a possible collapse of natural and socio-economic systems unless urgent action is taken. Key figures presented in the report include a doubling of fossil fuel subsidies between 2021 and 2022‚ reaching more than 1 trillion. In addition‚ the Canadian wildfires in 2023 have already released more carbon dioxide into the atmosphere than all of Canada’s greenhouse gas emissions in 2021. The report also notes an alarming rise in average global temperatures above pre-industrial levels‚ with 38 days in 2023 expected to exceed the 1.5 degrees Celsius threshold. The authors emphasize the need to develop policies that prioritize human well-being and address the overconsumption and excess emissions of the wealthy. Their recommendations include phasing out fossil fuel subsidies‚ promoting plant-based diets‚ protecting forests and implementing international treaties to limit the use of fossil fuels. The authors emphasize that climate action must be based on principles of equity and social justice‚ as the poorest people suffer disproportionately from climate impacts. The report ends with a call to action‚ saying that scientists and institutions have a moral responsibility to disseminate climate facts and make policy recommendations. They argue that scientists must play a leading role in addressing existential threats and alerting humanity to the need for urgent change. The post Earth’s vital signs have reached unprecedented levels appeared first on Anomalien.com.

The Biden White House will not tolerate disruptions during Propaganda Hour‚ otherwise known as the daily press briefing. Monday on the social media platform X‚ journalist Simon Ateba of Today News Africa posted the full text of a letter he reportedly received from the office of White House Press Secretary Karine Jean-Pierre — a letter… The post African Journalist Receives Threatening Letter from White House to Ban Him from Press Events: We ‘Warned You’ appeared first on The Federalist Papers.

As the contenders for the GOP presidential primary prepare to take to the stage in Tuscaloosa‚ AL‚ tonight (Dec. 6)‚ the ever-dwindling audience for these events is likely asking one question: What’s…

The lines have been drawn in Congress over funding for the war in Ukraine and border security. House Speaker Mike Johnson (R-La.) gave what was‚ in effect‚ an ultimatum to the president: no Ukraine funding…